Release 5.4.1 by dialvarezs · Pull Request #991 · nf-core/mag

dialvarezs · 2026-03-07T13:00:39Z

`Fixed`

#974 - Re-add accidently removed functionality for using metaSPAdes contigs downstream rather than scaffolds (reported by @Pranjal-Bioinfo, fix by @jfy133)
#984 - Fix docs regarding usage of Bin QC tool scores when filtering bins for post-processing (by @dialvarezs, @claude)
#987 - Fix several documentation issues (by @dialvarezs)
#988 - Fix regarding validation of column long_reads_platform in the input samplesheet (#985 by @vinisalazar)
#986 - Fix faulty ALE version YAML loading resulting in a snakeyaml error (by @jfy133)

Bump version post 5.4

The `gtdbtk_min_completeness` and `gtdbtk_max_contamination` parameters previously described filtering as applying only to BUSCO quality metrics. However, since v2.5 the pipeline supports multiple bin QC tools (BUSCO, CheckM, CheckM2) and the filter applies to results from any/all of them. Update help_text in nextflow_schema.json and descriptions in docs/output.md to accurately reflect that completeness and contamination filtering works across all available bin QC tools, not exclusively BUSCO. Fixes #983 https://claude.ai/code/session_01GFjgJHCGv7Jn9ZEdsVMv8p

Update GTDB-Tk QC documentation to include CheckM and CheckM2

Re-add contigs vs scaffolds metaSPAdes selection

Co-authored-by: James A. Fellows Yates <jfy133@gmail.com>

- Closes #985

Fix documentation issues

- Add #985

Update docs re: long_reads_platform

Fix faulty YAML loading issue

Co-authored-by: James A. Fellows Yates <jfy133@gmail.com>

Bump version for release v5.4.1

github-actions · 2026-03-07T13:04:01Z

`nf-core pipelines lint` overall result: Passed ✅ ⚠️

Posted for pipeline commit 577048b

+| ✅ 382 tests passed       |+
#| ❔   1 tests were ignored |#
!| ❗   7 tests had warnings |!

Details

❗ Test warnings:

nextflow_config - Config manifest.version should end in dev: 5.4.1
pipeline_todos - TODO string in main.nf: Remove this line if you don't need a FASTA file [TODO: try and test using for --host_fasta and --host_genome]
pipeline_todos - TODO string in methods_description_template.yml: #Update the HTML below to your preferred methods description, e.g. add publication citation for this pipeline
pipeline_todos - TODO string in nextflow.config: Specify any additional parameters here
pipeline_todos - TODO string in main.nf: Optionally add in-text citation tools to this list.
pipeline_todos - TODO string in main.nf: Optionally add bibliographic entries to this list.
pipeline_todos - TODO string in main.nf: Only uncomment below if logic in toolCitationText/toolBibliographyText has been filled!

❔ Tests ignored:

files_unchanged - File ignored due to lint config: .github/PULL_REQUEST_TEMPLATE.md

✅ Tests passed:

files_exist - File found: .gitattributes
files_exist - File found: .gitignore
files_exist - File found: .nf-core.yml
files_exist - File found: .prettierignore
files_exist - File found: .prettierrc.yml
files_exist - File found: CHANGELOG.md
files_exist - File found: CITATIONS.md
files_exist - File found: CODE_OF_CONDUCT.md
files_exist - File found: LICENSE or LICENSE.md or LICENCE or LICENCE.md
files_exist - File found: nextflow_schema.json
files_exist - File found: nextflow.config
files_exist - File found: README.md
files_exist - File found: .github/.dockstore.yml
files_exist - File found: .github/CONTRIBUTING.md
files_exist - File found: .github/ISSUE_TEMPLATE/bug_report.yml
files_exist - File found: .github/ISSUE_TEMPLATE/config.yml
files_exist - File found: .github/ISSUE_TEMPLATE/feature_request.yml
files_exist - File found: .github/PULL_REQUEST_TEMPLATE.md
files_exist - File found: .github/workflows/branch.yml
files_exist - File found: .github/workflows/nf-test.yml
files_exist - File found: .github/actions/get-shards/action.yml
files_exist - File found: .github/actions/nf-test/action.yml
files_exist - File found: .github/workflows/linting_comment.yml
files_exist - File found: .github/workflows/linting.yml
files_exist - File found: assets/email_template.html
files_exist - File found: assets/email_template.txt
files_exist - File found: assets/sendmail_template.txt
files_exist - File found: assets/nf-core-mag_logo_light.png
files_exist - File found: conf/modules.config
files_exist - File found: conf/test.config
files_exist - File found: conf/test_full.config
files_exist - File found: docs/images/nf-core-mag_logo_light.png
files_exist - File found: docs/images/nf-core-mag_logo_dark.png
files_exist - File found: docs/output.md
files_exist - File found: docs/README.md
files_exist - File found: docs/README.md
files_exist - File found: docs/usage.md
files_exist - File found: nf-test.config
files_exist - File found: tests/default.nf.test
files_exist - File found: main.nf
files_exist - File found: assets/multiqc_config.yml
files_exist - File found: conf/base.config
files_exist - File found: conf/igenomes.config
files_exist - File found: conf/igenomes_ignored.config
files_exist - File found: .github/workflows/awstest.yml
files_exist - File found: .github/workflows/awsfulltest.yml
files_exist - File found: modules.json
files_exist - File found: ro-crate-metadata.json
files_exist - File not found check: .github/ISSUE_TEMPLATE/bug_report.md
files_exist - File not found check: .github/ISSUE_TEMPLATE/feature_request.md
files_exist - File not found check: .github/workflows/push_dockerhub.yml
files_exist - File not found check: .markdownlint.yml
files_exist - File not found check: .nf-core.yaml
files_exist - File not found check: .yamllint.yml
files_exist - File not found check: bin/markdown_to_html.r
files_exist - File not found check: conf/aws.config
files_exist - File not found check: docs/images/nf-core-mag_logo.png
files_exist - File not found check: lib/Checks.groovy
files_exist - File not found check: lib/Completion.groovy
files_exist - File not found check: lib/NfcoreTemplate.groovy
files_exist - File not found check: lib/Utils.groovy
files_exist - File not found check: lib/Workflow.groovy
files_exist - File not found check: lib/WorkflowMain.groovy
files_exist - File not found check: lib/WorkflowMag.groovy
files_exist - File not found check: parameters.settings.json
files_exist - File not found check: pipeline_template.yml
files_exist - File not found check: Singularity
files_exist - File not found check: lib/nfcore_external_java_deps.jar
files_exist - File not found check: .travis.yml
nextflow_config - Found nf-schema plugin
nextflow_config - Config variable found: manifest.name
nextflow_config - Config variable found: manifest.nextflowVersion
nextflow_config - Config variable found: manifest.description
nextflow_config - Config variable found: manifest.version
nextflow_config - Config variable found: manifest.homePage
nextflow_config - Config variable found: timeline.enabled
nextflow_config - Config variable found: trace.enabled
nextflow_config - Config variable found: report.enabled
nextflow_config - Config variable found: dag.enabled
nextflow_config - Config variable found: process.cpus
nextflow_config - Config variable found: process.memory
nextflow_config - Config variable found: process.time
nextflow_config - Config variable found: params.outdir
nextflow_config - Config variable found: params.input
nextflow_config - Config variable found: manifest.mainScript
nextflow_config - Config variable found: timeline.file
nextflow_config - Config variable found: trace.file
nextflow_config - Config variable found: report.file
nextflow_config - Config variable found: dag.file
nextflow_config - Config variable (correctly) not found: params.nf_required_version
nextflow_config - Config variable (correctly) not found: params.container
nextflow_config - Config variable (correctly) not found: params.singleEnd
nextflow_config - Config variable (correctly) not found: params.igenomesIgnore
nextflow_config - Config variable (correctly) not found: params.name
nextflow_config - Config variable (correctly) not found: params.enable_conda
nextflow_config - Config variable (correctly) not found: params.max_cpus
nextflow_config - Config variable (correctly) not found: params.max_memory
nextflow_config - Config variable (correctly) not found: params.max_time
nextflow_config - Config variable (correctly) not found: params.validationFailUnrecognisedParams
nextflow_config - Config variable (correctly) not found: params.validationLenientMode
nextflow_config - Config variable (correctly) not found: params.validationSchemaIgnoreParams
nextflow_config - Config variable (correctly) not found: params.validationShowHiddenParams
nextflow_config - Config variable (correctly) not found: validation.failUnrecognisedParams
nextflow_config - Config variable (correctly) not found: validation.failUnrecognisedHeaders
nextflow_config - Config timeline.enabled had correct value: true
nextflow_config - Config report.enabled had correct value: true
nextflow_config - Config trace.enabled had correct value: true
nextflow_config - Config dag.enabled had correct value: true
nextflow_config - Config manifest.name began with nf-core/
nextflow_config - Config variable manifest.homePage began with https://github.com/nf-core/
nextflow_config - Config dag.file ended with .html
nextflow_config - Config variable manifest.nextflowVersion started with >= or !>=
nextflow_config - Config params.custom_config_version is set to master
nextflow_config - Config params.custom_config_base is set to https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Lines for loading custom profiles found
nextflow_config - nextflow.config contains configuration profile test
nextflow_config - Config default value correct: params.igenomes_base= s3://ngi-igenomes/igenomes/
nextflow_config - Config default value correct: params.custom_config_version= master
nextflow_config - Config default value correct: params.custom_config_base= https://raw.githubusercontent.com/nf-core/configs/master
nextflow_config - Config default value correct: params.publish_dir_mode= copy
nextflow_config - Config default value correct: params.max_multiqc_email_size= 25.MB
nextflow_config - Config default value correct: params.validate_params= true
nextflow_config - Config default value correct: params.pipelines_testdata_base_path= https://raw.githubusercontent.com/nf-core/test-datasets/
nextflow_config - Config default value correct: params.spades_fix_cpus= -1
nextflow_config - Config default value correct: params.spadeshybrid_fix_cpus= -1
nextflow_config - Config default value correct: params.metabat_rng_seed= 1
nextflow_config - Config default value correct: params.clip_tool= fastp
nextflow_config - Config default value correct: params.reads_minlength= 15
nextflow_config - Config default value correct: params.fastp_qualified_quality= 15
nextflow_config - Config default value correct: params.fastp_cut_mean_quality= 15
nextflow_config - Config default value correct: params.adapterremoval_minquality= 2
nextflow_config - Config default value correct: params.adapterremoval_adapter1= AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNATCTCGTATGCCGTCTTCTGCTTG
nextflow_config - Config default value correct: params.adapterremoval_adapter2= AGATCGGAAGAGCGTCGTGTAGGGAAAGAGTGTAGATCTCGGTGGTCGCCGTATCATT
nextflow_config - Config default value correct: params.bbnorm_target= 100
nextflow_config - Config default value correct: params.bbnorm_min= 5
nextflow_config - Config default value correct: params.longreads_min_length= 1000
nextflow_config - Config default value correct: params.longreads_keep_percent= 90
nextflow_config - Config default value correct: params.longreads_length_weight= 10
nextflow_config - Config default value correct: params.longread_adaptertrimming_tool= porechop_abi
nextflow_config - Config default value correct: params.longread_filtering_tool= filtlong
nextflow_config - Config default value correct: params.gtdb_db= https://data.gtdb.aau.ecogenomic.org/releases/release226/226.0/auxillary_files/gtdbtk_package/full_package/gtdbtk_r226_data.tar.gz
nextflow_config - Config default value correct: params.gtdbtk_min_completeness= 50.0
nextflow_config - Config default value correct: params.gtdbtk_max_contamination= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_perc_aa= 10.0
nextflow_config - Config default value correct: params.gtdbtk_min_af= 0.65
nextflow_config - Config default value correct: params.gtdbtk_pplacer_cpus= 1
nextflow_config - Config default value correct: params.spades_downstreaminput= scaffolds
nextflow_config - Config default value correct: params.genomad_min_score= 0.7
nextflow_config - Config default value correct: params.genomad_splits= 1
nextflow_config - Config default value correct: params.binning_map_mode= group
nextflow_config - Config default value correct: params.bin_metabinner_scale= large
nextflow_config - Config default value correct: params.semibin_rng_seed= 1
nextflow_config - Config default value correct: params.semibin_environment= global
nextflow_config - Config default value correct: params.min_contig_size= 1500
nextflow_config - Config default value correct: params.min_length_unbinned_contigs= 1000000
nextflow_config - Config default value correct: params.max_unbinned_contigs= 100
nextflow_config - Config default value correct: params.bin_min_size= 0
nextflow_config - Config default value correct: params.bin_concoct_chunksize= 10000
nextflow_config - Config default value correct: params.bin_concoct_overlap= 0
nextflow_config - Config default value correct: params.bin_domain_classification_tool= tiara
nextflow_config - Config default value correct: params.tiara_min_length= 3000
nextflow_config - Config default value correct: params.busco_db_lineage= auto
nextflow_config - Config default value correct: params.checkm_download_url= https://zenodo.org/records/7401545/files/checkm_data_2015_01_16.tar.gz
nextflow_config - Config default value correct: params.checkm2_db_version= 14897628
nextflow_config - Config default value correct: params.refine_bins_dastool_threshold= 0.5
nextflow_config - Config default value correct: params.postbinning_input= raw_bins_only
nextflow_config - Config default value correct: params.gunc_database_type= progenomes
nextflow_config - Config default value correct: params.pydamage_accuracy= 0.5
nextflow_config - Config default value correct: params.freebayes_ploidy= 1
nextflow_config - Config default value correct: params.freebayes_min_basequality= 20
nextflow_config - Config default value correct: params.freebayes_minallelefreq= 0.33
nextflow_config - Config default value correct: params.bcftools_view_high_variant_quality= 30
nextflow_config - Config default value correct: params.bcftools_view_medium_variant_quality= 20
nextflow_config - Config default value correct: params.bcftools_view_minimal_allelesupport= 3
nf_test_content - 'tests/test_longreadonly_alternatives.nf.test' contains outdir parameter
nf_test_content - 'tests/test_longreadonly_alternatives.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_longreadonly_alternatives.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/default.nf.test' contains outdir parameter
nf_test_content - 'tests/default.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/default.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_minimal.nf.test' contains outdir parameter
nf_test_content - 'tests/test_minimal.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_minimal.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_hybrid.nf.test' contains outdir parameter
nf_test_content - 'tests/test_hybrid.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_hybrid.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_single_end.nf.test' contains outdir parameter
nf_test_content - 'tests/test_single_end.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_single_end.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_longreadonly.nf.test' contains outdir parameter
nf_test_content - 'tests/test_longreadonly.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_longreadonly.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_assembly_input.nf.test' contains outdir parameter
nf_test_content - 'tests/test_assembly_input.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/test_alternatives.nf.test' contains outdir parameter
nf_test_content - 'tests/test_alternatives.nf.test' snapshots a 'versions.yml' file
nf_test_content - 'tests/nextflow.config' contains modules_testdata_base_path
nf_test_content - 'tests/nextflow.config' contains pipelines_testdata_base_path
nf_test_content - 'nf-test.config' sets a testsDir
nf_test_content - 'nf-test.config' sets a workDir
nf_test_content - 'nf-test.config' sets a configFile
files_unchanged - .gitattributes matches the template
files_unchanged - .prettierrc.yml matches the template
files_unchanged - CODE_OF_CONDUCT.md matches the template
files_unchanged - LICENSE matches the template
files_unchanged - .github/.dockstore.yml matches the template
files_unchanged - .github/CONTRIBUTING.md matches the template
files_unchanged - .github/ISSUE_TEMPLATE/bug_report.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/config.yml matches the template
files_unchanged - .github/ISSUE_TEMPLATE/feature_request.yml matches the template
files_unchanged - .github/workflows/branch.yml matches the template
files_unchanged - .github/workflows/linting_comment.yml matches the template
files_unchanged - .github/workflows/linting.yml matches the template
files_unchanged - assets/email_template.html matches the template
files_unchanged - assets/email_template.txt matches the template
files_unchanged - assets/sendmail_template.txt matches the template
files_unchanged - assets/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_light.png matches the template
files_unchanged - docs/images/nf-core-mag_logo_dark.png matches the template
files_unchanged - docs/README.md matches the template
files_unchanged - .gitignore matches the template
files_unchanged - .prettierignore matches the template
actions_nf_test - '.github/workflows/nf-test.yml' is triggered on expected events
actions_nf_test - '.github/workflows/nf-test.yml' checks minimum NF version
actions_awstest - '.github/workflows/awstest.yml' is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml is triggered correctly
actions_awsfulltest - .github/workflows/awsfulltest.yml does not use -profile test
readme - README Nextflow minimum version badge matched config. Badge: 25.04.2, Config: 25.04.2
readme - README nf-core template version badge found.
readme - README Zenodo placeholder was replaced with DOI.
pipeline_if_empty_null - No ifEmpty(null) strings found
plugin_includes - No wrong validation plugin imports have been found
pipeline_name_conventions - Name adheres to nf-core convention
template_strings - Did not find any Jinja template strings (0 files)
schema_lint - Schema lint passed
schema_lint - Schema title + description lint passed
schema_lint - Input mimetype lint passed: 'text/csv'
schema_params - Schema matched params returned from nextflow config
system_exit - No System.exit calls found
actions_schema_validation - Workflow validation passed: branch.yml
actions_schema_validation - Workflow validation passed: fix_linting.yml
actions_schema_validation - Workflow validation passed: clean-up.yml
actions_schema_validation - Workflow validation passed: linting.yml
actions_schema_validation - Workflow validation passed: awsfulltest.yml
actions_schema_validation - Workflow validation passed: template-version-comment.yml
actions_schema_validation - Workflow validation passed: nf-test.yml
actions_schema_validation - Workflow validation passed: labeler.yml
actions_schema_validation - Workflow validation passed: download_pipeline.yml
actions_schema_validation - Workflow validation passed: awstest.yml
actions_schema_validation - Workflow validation passed: release-announcements.yml
actions_schema_validation - Workflow validation passed: linting_comment.yml
merge_markers - No merge markers found in pipeline files
modules_json - Only installed modules found in modules.json
multiqc_config - assets/multiqc_config.yml found and not ignored.
multiqc_config - assets/multiqc_config.yml contains report_section_order
multiqc_config - assets/multiqc_config.yml contains export_plots
multiqc_config - assets/multiqc_config.yml contains report_comment
multiqc_config - assets/multiqc_config.yml follows the ordering scheme of the minimally required plugins.
multiqc_config - assets/multiqc_config.yml contains a matching 'report_comment'.
multiqc_config - assets/multiqc_config.yml contains 'export_plots: true'.
modules_structure - modules directory structure is correct 'modules/nf-core/TOOL/SUBTOOL'
local_component_structure - local subworkflows directory structure is correct 'subworkflows/local/TOOL/SUBTOOL'
base_config - conf/base.config found and not ignored.
base_config - BOWTIE2_HOST_REMOVAL_BUILD found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/base.config and Nextflow scripts.
base_config - PORECHOP_PORECHOP found in conf/base.config and Nextflow scripts.
base_config - NANOLYSE found in conf/base.config and Nextflow scripts.
base_config - FILTLONG found in conf/base.config and Nextflow scripts.
base_config - CATPACK_BINS found in conf/base.config and Nextflow scripts.
base_config - CATPACK_CONTIGS found in conf/base.config and Nextflow scripts.
base_config - GTDBTK_CLASSIFYWF found in conf/base.config and Nextflow scripts.
base_config - MEGAHIT found in conf/base.config and Nextflow scripts.
base_config - METASPADES found in conf/base.config and Nextflow scripts.
base_config - METASPADESHYBRID found in conf/base.config and Nextflow scripts.
base_config - METAMDBG_ASM found in conf/base.config and Nextflow scripts.
base_config - FLYE found in conf/base.config and Nextflow scripts.
base_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/base.config and Nextflow scripts.
base_config - METABAT2_METABAT2 found in conf/base.config and Nextflow scripts.
base_config - MAG_DEPTHS found in conf/base.config and Nextflow scripts.
base_config - MAG_DEPTHS_PLOT found in conf/base.config and Nextflow scripts.
base_config - BUSCO_BUSCO found in conf/base.config and Nextflow scripts.
base_config - MAXBIN2 found in conf/base.config and Nextflow scripts.
base_config - COMEBIN_RUNCOMEBIN found in conf/base.config and Nextflow scripts.
base_config - METABINNER_METABINNER found in conf/base.config and Nextflow scripts.
base_config - DASTOOL_DASTOOL found in conf/base.config and Nextflow scripts.
base_config - CHECKM_LINEAGEWF found in conf/base.config and Nextflow scripts.
base_config - CHECKM2_PREDICT found in conf/base.config and Nextflow scripts.
modules_config - conf/modules.config found and not ignored.
modules_config - FASTQC_RAW found in conf/modules.config and Nextflow scripts.
modules_config - FASTP found in conf/modules.config and Nextflow scripts.
modules_config - TRIMMOMATIC found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_PE found in conf/modules.config and Nextflow scripts.
modules_config - ADAPTERREMOVAL_SE found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_PHIX_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_HOST_REMOVAL_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - FASTQC_TRIMMED found in conf/modules.config and Nextflow scripts.
modules_config - BBMAP_BBNORM found in conf/modules.config and Nextflow scripts.
modules_config - PORECHOP_PORECHOP found in conf/modules.config and Nextflow scripts.
modules_config - PORECHOP_ABI found in conf/modules.config and Nextflow scripts.
modules_config - FILTLONG found in conf/modules.config and Nextflow scripts.
modules_config - NANOQ found in conf/modules.config and Nextflow scripts.
modules_config - NANOLYSE found in conf/modules.config and Nextflow scripts.
modules_config - CHOPPER found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_RAW found in conf/modules.config and Nextflow scripts.
modules_config - NANOPLOT_FILTERED found in conf/modules.config and Nextflow scripts.
modules_config - MINIMAP2_HOST_INDEX found in conf/modules.config and Nextflow scripts.
modules_config - MINIMAP2_HOST_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - MINIMAP2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_HOSTREMOVED_UNMAPPED found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_HOSTREMOVED_STATS found in conf/modules.config and Nextflow scripts.
modules_config - MEGAHIT found in conf/modules.config and Nextflow scripts.
modules_config - METASPADES found in conf/modules.config and Nextflow scripts.
modules_config - METASPADESHYBRID found in conf/modules.config and Nextflow scripts.
modules_config - FLYE found in conf/modules.config and Nextflow scripts.
modules_config - METAMDBG_ASM found in conf/modules.config and Nextflow scripts.
modules_config - QUAST found in conf/modules.config and Nextflow scripts.
modules_config - ALE found in conf/modules.config and Nextflow scripts.
modules_config - QUAST_BINS found in conf/modules.config and Nextflow scripts.
modules_config - GENOMAD_ENDTOEND found in conf/modules.config and Nextflow scripts.
modules_config - BOWTIE2_ASSEMBLY_ALIGN found in conf/modules.config and Nextflow scripts.
modules_config - MAG_DEPTHS_PLOT found in conf/modules.config and Nextflow scripts.
modules_config - BIN_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_UNTAR found in conf/modules.config and Nextflow scripts.
modules_config - BUSCO_BUSCO found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_UNTAR found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_LINEAGEWF found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM_QA found in conf/modules.config and Nextflow scripts.
modules_config - CONCAT_BUSCO_TSV found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM2_DATABASEDOWNLOAD found in conf/modules.config and Nextflow scripts.
modules_config - CHECKM2_PREDICT found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_DOWNLOADDB found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_RUN found in conf/modules.config and Nextflow scripts.
modules_config - GUNC_MERGECHECKM found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_PREPARE found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_BINS found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_ADDNAMES_BINS found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_SUMMARISE_BINS found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_UNBINS found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_ADDNAMES_UNBINS found in conf/modules.config and Nextflow scripts.
modules_config - CATPACK_SUMMARISE_UNBINS found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_CLASSIFYWF found in conf/modules.config and Nextflow scripts.
modules_config - GTDBTK_SUMMARY found in conf/modules.config and Nextflow scripts.
modules_config - PROKKA found in conf/modules.config and Nextflow scripts.
modules_config - PRODIGAL found in conf/modules.config and Nextflow scripts.
modules_config - FREEBAYES found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_VIEW found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_CONSENSUS found in conf/modules.config and Nextflow scripts.
modules_config - BCFTOOLS_INDEX found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_ANALYZE found in conf/modules.config and Nextflow scripts.
modules_config - PYDAMAGE_FILTER found in conf/modules.config and Nextflow scripts.
modules_config - SUMMARISE_PYDAMAGEBINS found in conf/modules.config and Nextflow scripts.
modules_config - SAMTOOLS_FAIDX found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS_SHORTREAD found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_JGISUMMARIZEBAMCONTIGDEPTHS_LONGREAD found in conf/modules.config and Nextflow scripts.
modules_config - METABAT2_METABAT2 found in conf/modules.config and Nextflow scripts.
modules_config - MAXBIN2 found in conf/modules.config and Nextflow scripts.
modules_config - ADJUST_MAXBIN2_EXT found in conf/modules.config and Nextflow scripts.
modules_config - CONCOCT_CUTUPFASTA found in conf/modules.config and Nextflow scripts.
modules_config - CONCOCT_ found in conf/modules.config and Nextflow scripts.
modules_config - COMEBIN_RUNCOMEBIN found in conf/modules.config and Nextflow scripts.
modules_config - METABINNER_KMER found in conf/modules.config and Nextflow scripts.
modules_config - METABINNER_TOOSHORT found in conf/modules.config and Nextflow scripts.
modules_config - METABINNER_METABINNER found in conf/modules.config and Nextflow scripts.
modules_config - METABINNER_BINS found in conf/modules.config and Nextflow scripts.
modules_config - SEMIBIN_SINGLEEASYBIN found in conf/modules.config and Nextflow scripts.
modules_config - SEQKIT_STATS found in conf/modules.config and Nextflow scripts.
modules_config - SPLIT_FASTA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_FASTATOCONTIG2BIN found in conf/modules.config and Nextflow scripts.
modules_config - DASTOOL_DASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - RENAME_POSTDASTOOL found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_TIARA found in conf/modules.config and Nextflow scripts.
modules_config - TIARA_CLASSIFY found in conf/modules.config and Nextflow scripts.
modules_config - CONCAT_TIARA_TSV found in conf/modules.config and Nextflow scripts.
modules_config - MMSEQS_DATABASES found in conf/modules.config and Nextflow scripts.
modules_config - METAEUK_EASYPREDICT found in conf/modules.config and Nextflow scripts.
modules_config - MULTIQC found in conf/modules.config and Nextflow scripts.
modules_config - BIGMAG found in conf/modules.config and Nextflow scripts.
nfcore_yml - Repository type in .nf-core.yml is valid: pipeline
nfcore_yml - nf-core version in .nf-core.yml is set to the latest version: 3.5.2
rocrate_readme_sync - RO-Crate descriptions are in sync with README.md.

Run details

nf-core/tools version 3.5.2
Run at 2026-03-07 13:03:44

jfy133 · 2026-03-07T15:39:27Z

CHANGELOG.md

+| Tool | Previous version | New version |
+| ---- | ---------------- | ----------- |
+|      |                  |             |


Suggested change

| Tool | Previous version | New version |

| ---- | ---------------- | ----------- |

| | | |

So people don't think we missd something

jfy133 and others added 30 commits February 2, 2026 15:38

Bump verswion post 5.4

a87ce27

Bump in snapshots

76f4670

Merge pull request #973 from nf-core/post-yellow-frog-version-bump

665d5e3

Bump version post 5.4

Re-add contigs vs scaffolds metaSPAdes selection

c00d519

update minimap2 modules to see if it fixes yaml loading isseus

9aefaa1

Remove correct line

3e8489a

Try removing ifEmpty on ALE mixing

a6d77dd

Merge branch 'dev' into claude/fix-issue-983-DcUiG

b808556

Update changelog

3d47e54

Clarify on how the multiple qc scores are used against the thresholds

f88f8ff

Merge pull request #984 from nf-core/claude/fix-issue-983-DcUiG

608db5c

Update GTDB-Tk QC documentation to include CheckM and CheckM2

Merge branch 'dev' into readd-spades-contigs-option

b62c357

Fix naming of bin_*_size parameters

c1b97e1

Fix naming of save_checkm_data parameter

e3c07a2

Fix run_checkm parameter

9c00d80

Fix skip_ancient_damagecorrection parameter

822a020

Fix output paths

d7161b7

Remove raw read taxonomic classification from output overview

2c88841

Fix minimap2 host align output path

0cf49b9

Fix schema helps

4662a23

Clarify requirement of group in assembly_input

c1a34c8

Fix pydamage and adna variants outputs

04dcdd5

Merge pull request #979 from nf-core/readd-spades-contigs-option

4ae8852

Re-add contigs vs scaffolds metaSPAdes selection

Update GTDB docs to match current default (r226)

b7de254

Update resources and custom tool args docs to make them related to mag

4c81383

Fix typos

c5732a9

Merge remote-tracking branch 'upstream/dev' into fix-docs

2e0ddea

Update changelog

b09c2d7

Update CHANGELOG.md

eca6135

Co-authored-by: James A. Fellows Yates <jfy133@gmail.com>

vinisalazar and others added 17 commits March 5, 2026 12:56

Update docs re: long_reads_platform

62ab602

- Closes #985

Merge branch 'dev' into issue-985

defe8af

Merge pull request #987 from dialvarezs/fix-docs

0e39a92

Fix documentation issues

Update CHANGELOG.md

11ebc3d

- Add #985

Merge branch 'dev' into issue-985

21a3132

Merge pull request #988 from vinisalazar/issue-985

08da36c

Update docs re: long_reads_platform

Update snapshots

e7ced22

Merge branch 'dev' into minimap2-yaml-issue

8e389e4

Merge remote-tracking branch 'upstream/dev' into minimap2-yaml-issue

7f9a203

Update changelog

cebc848

Merge pull request #986 from nf-core/minimap2-yaml-issue

ee6d96d

Fix faulty YAML loading issue

Bump version

a2cd096

Update snapshots

c777470

Bump nf-core version

9838584

Update CHANGELOG.md

9f0e3ea

Co-authored-by: James A. Fellows Yates <jfy133@gmail.com>

Update CHANGELOG.md

5150911

Co-authored-by: James A. Fellows Yates <jfy133@gmail.com>

Merge pull request #990 from dialvarezs/bump-version-5.4.1

577048b

Bump version for release v5.4.1

dialvarezs requested review from d4straub, jfy133, muabnezor and prototaxites as code owners March 7, 2026 13:00

github-actions bot added the size/l label Mar 7, 2026

jfy133 approved these changes Mar 7, 2026

View reviewed changes

Provide feedback

Saved searches

Use saved searches to filter your results more quickly

Release 5.4.1#991

Release 5.4.1#991
dialvarezs wants to merge 47 commits intomainfrom
dev

dialvarezs commented Mar 7, 2026

Uh oh!

github-actions bot commented Mar 7, 2026 •

edited

Loading

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

Uh oh!

jfy133 Mar 7, 2026

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

4 participants

	\| Tool \| Previous version \| New version \|
	\| ---- \| ---------------- \| ----------- \|
	\| \| \| \|

Conversation

dialvarezs commented Mar 7, 2026

Fixed

Uh oh!

github-actions bot commented Mar 7, 2026 • edited Loading Uh oh! There was an error while loading. Please reload this page.

Uh oh!

nf-core pipelines lint overall result: Passed ✅ ⚠️

❗ Test warnings:

❔ Tests ignored:

✅ Tests passed:

Run details

Uh oh!

jfy133 Mar 7, 2026

Choose a reason for hiding this comment

Uh oh!

Reviewers

Assignees

Labels

Projects

Milestone

Development

Uh oh!

4 participants

`Fixed`

github-actions bot commented Mar 7, 2026 •

edited

Loading

`nf-core pipelines lint` overall result: Passed ✅ ⚠️